PDF Archive

Easily share your PDF documents with your contacts, on the Web and Social Networks.

Share a file Manage my documents Convert Recover PDF Search Help Contact



2010 Colinet et al. FEBS .pdf



Original filename: 2010 Colinet et al. FEBS.pdf
Title: untitled

This PDF 1.3 document has been generated by 3B2 Total Publishing System 8.07e/W / Acrobat Distiller 7.0 (Windows), and has been sent on pdf-archive.com on 07/07/2015 at 22:23, from IP address 93.182.x.x. The current document download page has been viewed 644 times.
File size: 304 KB (12 pages).
Privacy: public file




Download original PDF file









Document preview


Temporal expression of heat shock genes during cold
stress and recovery from chill coma in adult
Drosophila melanogaster
Herve´ Colinet1,2, Siu Fai Lee2 and Ary Hoffmann2
1 Unite´ d’E´cologie et de Bioge´ographie, Biodiversity Research Centre, Universite´ catholique de Louvain, Louvain-la-Neuve, Belgium
2 Department of Genetics, Centre for Environmental Stress and Adaptation Research, Bio21 Institute, University of Melbourne, Parkville,
Australia

Keywords
cold stress; Drosophila melanogaster; gene
expression; Hsp; recovery
Correspondence
H. Colinet, Bio21 Institute, University of
Melbourne, 30 Flemington Road, Parkville,
Victoria 3010, Australia
Fax: +61 3 8344 2279
Tel: +61 3 8344 2520
E-mail: herve.colinet@uclouvain.be
(Received 9 September 2009, revised 28
October 2009, accepted 30 October 2009)
doi:10.1111/j.1742-4658.2009.07470.x

A common physiological response of organisms to environmental stresses
is the increase in expression of heat shock proteins (Hsps). In insects, this
process has been widely examined for heat stress, but the response to cold
stress has been far less studied. In the present study, we focused on 11 Drosophila melanogaster Hsp genes during the stress exposure and recovery
phases. The temporal gene expression of adults was analyzed during 9 h of
cold stress at 0 C and during 8 h of recovery at 25 C. Increased expression of some, but not all, Hsp genes was elicited in response to cold stress.
The transcriptional activity of Hsp genes was not modulated during the
cold stress, and peaks of expression occurred during the recovery phase.
On the basis of their response, we consider that Hsp60, Hsp67Ba and
Hsc70-1 are not cold-inducible, whereas Hsp22, Hsp23, Hsp26, Hsp27,
Hsp40, Hsp68, Hsp70Aa and Hsp83 are induced by cold. This study suggests the importance of the recovery phase for repairing chilling injuries,
and highlights the need to further investigate the contributions of specific
Hsp genes to thermal stress responses. Parallels are drawn between the
stress response networks resulting from heat and cold stress.

Introduction
Temperature plays a crucial role in determining the
distribution and abundance of animals. In insects and
other ectotherms, temperature simultaneously affects
physiological processes, biophysical structures, and
metabolic activities, as well as developmental rates and
growth [1]. Many insect species are seasonally exposed
to suboptimal or supraoptimal temperatures, and this
has led to the evolution of protective biochemical and
physiological mechanisms. For example, heat shock
proteins (Hsps) are considered to play crucial roles in
environmental stress tolerance and in thermal adaptation [2–5]. Hsp genes constitute a subset of a larger

group of genes coding for molecular chaperones. Their
functions include transport, folding, unfolding, assembly ⁄ disassembly, and degradation of misfolded or
aggregated proteins [2,5,6].
Many Hsps are upregulated in response to a diverse
array of stresses [2]. In arthropods, they are induced
by environmental stressors such as heat, heavy metals,
ethanol, and desiccation [3,7,8]. The possibility that
cold stress could elicit heat stress responses has not
been investigated in many biological systems [9]. The
molecular basis of adaptation to nonfreezing low
temperatures has not received as much attention as the

Abbreviations
Cp, crossing point; Ct, cycle threshold; HSF, heat shock factor; Hsp, heat shock protein; qRT-PCR, quantitative RT-PCR; RA, recovery with
agar; RF, recovery with food; RNAi, RNA interference; sHsp, small heat shock protein.

174

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

H. Colinet et al.

Heat shock response to cold stress

high temperature extreme [10,11]. The first report of a
cold-induced heat shock response in insects was provided by Burton et al. [12], who noticed the induction
of a 70 kDa protein after a cold treatment. However,
the biochemical diversity of cold-induced heat shock
responses remains poorly understood, because much of
the early work [12–14] used one-dimensional gel electrophoresis, which fails to discriminate different Hsps
within a family [15]. Hsps are usually divided into different families on the basis of their sequence homology
and their molecular masses. The major families include
Hsp100, Hsp90, Hsp70, Hsp60, Hsp40, and the small
Hsps (sHsps) (sizes below 30 kDa) [2,3].
The molecular mechanisms behind recovery from
cold shock are complex, and it seems that more
genes ⁄ proteins are activated during the recovery phases
than during the actual period of the cold stress itself
[16]. It is thus essential to differentiate between the
cold exposure and the subsequent recovery phase
[16,17], and this aspect was investigated in studies
using alternating temperatures [18–20]. Although Hsps
have been implicated in cold survival, there is little
direct evidence in the literature to confirm this link
[21]. In insects, there has been a long-standing focus
on Hsp70, which remains the most commonly studied
stress protein in cold-related studies [11,16,21]. Even if
the level of Hsp70 expression is a good indicator of
the whole inducible stress response, studying it alone
gives an incomplete picture of the organism’s stress
response [11]. Hsp70 is known to interact with a
network of other Hsps [22–24]. Therefore, if Hsp70
displays mild modulation under a specific condition, it
is possible that changes in the expression of other Hsp
genes or Hsp proteins might occur and might be overlooked [11]. In the present study, we investigated the

temporal expression patterns of 11 Hsp genes in adult
Drosophila melanogaster during both the cold stress
exposure phase and the recovery phase.

Results and Discussion
Adult flies were subjected to prolonged cold stress for
up to 9 h at 0 C, and then allowed to recover at
25 C for up to 8 h, with or without food (Fig. 1). We
investigated the temporal expression patterns of 11
Hsp genes during both the cold stress phase and the
recovery phase, using quantitative RT-PCR (qRTPCR). At 0 C, adults fall directly into chill coma,
because of the inability to maintain muscle resting
potentials [25]. In addition to this neuromuscular perturbation, chilling injuries accumulate at low temperatures as a result of various physiological dysfunctions,
recently reviewed by Chown and Terblanche [26].
Within certain limits, these physiological injuries are
reversible. As previously noted in D. melanogaster [27],
when the cold stress period is increased, the associated
chilling injuries accumulate, and the time needed for
recovery increases. In our experiments, recovery times
(Fig. 2) followed periods of stress exposure, increasing
significantly with time spent at 0 C (ANOVA;
F = 239.2; degrees of freedom = 3,156; P < 0.0001).
Recovery time is a highly variable physiological trait.
We observed that coefficients of variation ranged from
10% to 13% for stress duration of 0.25–6 h, and then
increased to 28% for 9 h of cold stress. As often
observed in animals, the phenotypic variability of a
trait increases rather than decreases when the level of
stress becomes more severe [7]. There was no mortality
even after 9 h of cold stress, ensuring that expression
changes were not confounded by mortality.
Recovered with food (RF)

Stressed (S)
25 °C

0.25 h

3h

0.5 h

6h

2h

4h

8h

9h
25 °C

0 °C
25 °C

0.5 h

2h

4h

8h

Recovered with agar (RA)

Corresponding controls
25 °C

0h

3h

6h

9h

11 h

13 h

17 h

Fig. 1. Experimental protocol used to evaluate the cumulative effects of prolonged cold stress followed by a recovery period on expression
of Hsp genes. Treated flies were stressed (S) at 0 C for periods ranging from 0.25 to 9 h, and allowed to recover at 25 C with food (RF) or
with only agar (RA) for periods ranging from 0.5 to 8 h. Samples for gene expression measurements were taken at several time points
during the cold stress and the recovery treatments (see text for further details). Control flies were kept at 25 C and were sampled at the
same time points as the treated flies.

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

175

Heat shock response to cold stress

H. Colinet et al.

Table 1. Primer pairs used for qRT-PCR.

Fig. 2. Increasing recovery time for flies exposed to increasing
durations of cold stress. Each circle represents the value of an individual fly. Means are indicated ± standard errors (n = 40).

We focused on 11 Hsp genes representing all major
Hsp families. Because chilling injury is a cumulative
process, we verified whether Hsp transcripts, other
than those of Hsp70, accumulate during cold stress.
All qRT-PCR assays yielded specific products (i.e. single melting peak), and qRT-PCR efficiencies were
between 80% and 101%. There was no difference in
the relative expression of the housekeeping gene RpS20
between all treatment–duration combinations, including controls (ANOVA; F = 0.656; degrees of freedom = 11,30; P = 0.766).
Hsp70 and Hsp68
Of the 11 Hsp genes examined, Hsp70Aa and Hsp68
were the most cold-inducible, with overall expression
being treatment-specific, and expression being upregulated during recovery treatments (Table 2 and Fig. 3).
Hsp70Aa was only marginally upregulated towards the
end of the cold stress, but was upregulated 68-fold
after 2 h of recovery. Upon commencement of the
25 C recovery, the accumulation of Hsp68 transcripts
underwent a 0.5 h delay before peaking at 2 h of
recovery with 22-fold upregulation. Goto and Kimura
[28] also found that in some temperate species of Drosophila, Hsp70 mRNA accumulated after the flies were
returned to 23 C following cold treatment. The only
exception was Drosophila watanabei, where a low level

Gene

Primer sequence (5¢- to 3¢)

RpS20 (forward)
RpS20 (reverse)
Hsp22 (forward)
Hsp22 (reverse)
Hsp23 (forward)
Hsp23 (reverse)
Hsp26 (forward)
Hsp26 (reverse)
Hsp27 (forward)
Hsp27 (reverse)
Hsp40 (forward)
Hsp40 (reverse)
Hsp60 (forward)
Hsp60 (reverse)
Hsp67Ba (forward)
Hsp67Ba (reverse)
Hsp68 (forward)
Hsp68 (reverse)
Hsp70Aa (forward)
Hsp70Aa (reverse)
Hsc70-1 (forward)
Hsc70-1 (reverse)
Hsp83 (forward)
Hsp83 (reverse)

CCGCATCACCCTGACATCC
TGGTGATGCGAAGGGTCTTG
GCCTCTCCTCGCCCTTTCAC
TCCTCGGTAGCGCCACACTC
GGTGCCCTTCTATGAGCCCTACTAC
CCATCCTTTCCGATTTTCGACAC
GTCACATCATGCGCCACTTTG
TTGTAGCCATCGGGAACCTTGTAG
GGCCACCACAATCAAATGTCAC
CTCCTCGTGCTTCCCCTCTACC
GAGATCATCAAGCCCACCACAAC
CGGGAAACTTAATGTCGAAGGAGAC
ACATCTCGCCGTACTTCATCAACTC
GGAGGAGGGCATCTTGGAACTC
TGGATGAACCCACACCCAATC
CGAGGCAACGGGCACTTC
GAAGGCACTCAAGGACGCTAAAATG
CTGAACCTTGGGAATACGAGTG
TCGATGGTACTGACCAAGATGAAGG
GAGTCGTTGAAGTAGGCTGGAACTG
TGCTGGATGTCACTCCTCTGTCTC
TGGGTATGGTGGTGTTCCTCTTAATC
GGACAAGGATGCCAAGAAGAAGAAG
CAGTCGTTGGTCAGGGATTTGTAG

Fragment
length (bp)
134
66
153
52
171
112
66
89
88
98
87
150

of upregulation of Hsp70 mRNA was observed, not
only during cold exposure, but also during recovery
from cold. Using RNA interference (RNAi), recent
studies on other insect species have demonstrated that
Hsp70 is critically important for cold survival [29,30].
Hsp68, which belongs to the Hsp70 family, was highly
expressed during recovery. Hsp68 is induced by heat
stress in Drosophila [23,31,32], but there is no previous
report of cold induction in this gene. Hsp68 is thought
to have a similar function to Hsp70 in the protection
and ⁄ or renaturation of proteins, but this function may
be part of a temporally different response [31].
Hsp40 and Hsp83
Hsp40 (also called DnaJ-1) had a fairly high level of
basal expression in untreated flies (relative to the
housekeeping gene RpS20), confirming that it is a constitutively expressed gene [22]. Hsp40 was upregulated

Fig. 3. Mean relative expression (+standard error), based on log2 transformation of qRT-PCR ratios of the assayed Hsp genes relative to
RpS20. White bars represent flies exposed to cold stress (S) for periods ranging from 0.25 to 9 h (S05–S9). Gray and black bars represent
flies recovering from 9 h of cold stress at 25 C with food (RF) or agar (RA), respectively, for periods ranging from 0.5 to 8 h (R05F–R8F and
R05A–R8A). The symbol (w) indicates mean values that are significantly (P < 0.05) different from 0. A value equal to 0 indicates no difference in expression level from control flies, whereas positive and negative values indicate upregulation and downregulation, respectively.

176

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

H. Colinet et al.

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

Heat shock response to cold stress

177

Heat shock response to cold stress

H. Colinet et al.

during the recovery period (Table 2 and Fig. 3), without a lag period; expression was already significantly
different from that of the control after 0.5 h of recovery (P < 0.05). A peak of Hsp40 expression was
observed after 2 h of recovery. Hsp40 is known to
respond to heat stress in Drosophila [23,33], but this
particular Hsp gene has not previously been reported
to be cold-inducible. Hsp40 is an essential cofactor
that interacts with the members of the Hsp70 family.
It accelerates the dissociation of the ADP–Hsp70 complex, and therefore an increase in Hsp40 concentration
may cause an increase in Hsp70 activity [34]. Likewise,
the expression of Hsp83 (a homolog of mammalian
Hsp90) was not modulated during cold stress, but was
upregulated during the recovery period (Table 2 and
Fig. 3). After 2 h of recovery, there was significant
modulation, reaching 3.4-fold. Hsp83 was highly
expressed in control flies (nearly as much as RpS20),
confirming its constitutive expression [22,35]. The
Hsp90 family gene has been implicated as having a
role in the insect diapause. In this context, Hsp90
mRNA levels display species-specific modulation, being
either upregulated [36,37], downregulated [29], or
unregulated [38]. Whereas, in diapausing insects,
expression results are conflicting, in nondiapausing
insects upregulation of Hsp90 following cold treatment
seems to be a general rule [28,35,36], and our Drosophila data confirm this.
sHsp genes
All four members of the sHsp family (Hsp22, Hsp23,
Hsp26, and Hsp27) showed similar temporal patterns
of expression (Fig. 3), which differed among treatments (Table 2). The mRNA levels did not show any
modulation relative to controls during the cold stress
and in the early stage of the recovery phase. After this

period, gene expression was significantly upregulated.
A marked peak of expression occurred after 2 h of
recovery, with average fold changes relative to controls
ranging from four-fold to eight-fold (Fig. 3).
Only a few studies have analyzed sHsp expression in
relation to cold stress in insects. Yocum et al. [39]
found that expression of the Hsp23 transcript of the
nondiapausing flesh fly was induced in response to
both severe heat and cold shocks (43 C and )10 C
for 2 h). Sinclair et al. [17] did not observe any modulation of Hsp23 transcription during recovery from a
short cold stress (3 h at 0 C) in D. melanogaster. Perhaps, as for Hsp70 [12], it takes several hours under
mild cold stress to obtain a response in sHsp genes.
However, in the same species, Qin et al. [40] reported
the upregulation of Hsp23 and Hsp26 during a 30 min
recovery phase preceded by a cold stress of only 2 h at
0 C. In the present study, flies were stressed for 9 h at
0 C, and we observed upregulation of four sHsp genes
during recovery. The reason why D. melanogaster has
four structurally similar sHsps is still unclear [41]. In
addition to their molecular chaperone function, sHsps
are involved in various processes [4], some of which
are important for insect cold tolerance. Suppressing
the expression of Hsp23 by using RNAi undermines
insect survival at low temperature [29]. Our expression
results suggest that sHsps may play an important role
in cold tolerance. Hsp22 is a key player in cell protection against oxidative injuries [42], a typical feature of
chilling injury [43]. In addition, sHsps are effective in
preserving the integrity of the actin cytoskeleton and
microfilaments [44]. This function is particularly
important, because there is increasing evidence that
cytoskeletal components are involved in insect cold
tolerance [19,45]. Finally, sHsps prevent caspasedependent apoptosis [46], a process that occurs during
heat and cold stress in Drosophila cells [47].

Table 2 . Comparison of the overall expression of Hsp genes between the three treatments: cold stress (S), RF, and RA. Different letters in
the same line indicate a significant pairwise difference between treatments by least significant difference tests after ANOVA (a = 0.05).

Hsp22
Hsp23
Hsp26
Hsp27
Hsp40
Hsp60
Hsp67Ba
Hsp68
Hsp70Aa
Hsc70-1
Hsp83

178

FlyBase ID

F

FBgn0001223
FBgn0001224
FBgn0001225
FBgn0001226
FBgn0015657
FBgn0015245
FBgn0001227
FBgn0001230
FBgn0013275
FBgn0001216
FBgn0001233

3.751
10.78
12.02
14.00
25.91
0.31
2.51
20.23
81.51
0.514
20.20

P

<
<
<

<
<
<

0.032
0.0002
0.0001
0.0001
0.0001
0.729
0.093
0.0001
0.0001
0.601
0.0001

S

RF

RA

a
a
a
a
a
a
a
a
a
a
a

b
b
b
b
b
a
a
b
b
a
b

b
b
b
b
b
a
a
b
b
a
b

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

H. Colinet et al.

Other Hsp genes
The mRNA levels of Hsp60, Hsp67Ba and Hsc70-1
did not show any significant modulation relative to
controls during cold stress and during recovery periods
(Table 2 and Fig. 3). In contrast to Hsp70, little is
known about the significance of eukaryotic Hsp60 [48].
Hsp60 had a fairly high level of basal expression (relative to the housekeeping gene RpS20), confirming its
constitutive expression [49]. Heat stress does not modulate the expression of Hsp60 transcripts in Drosophila
[23,32], but it increases the expression of Hsp60 in the
blowfly [48]. Our data indicate that cold stress does
not upregulate transcriptional expression of Hsp60,
suggesting that this gene is not induced by thermal
stress (heat and cold), at least in D. melanogaster.
Hsc70, a member of the Hsp70 family, is constitutively
expressed under nonstress conditions [2]. In insects,
Hsc70 displays species-specific transcriptional changes
in response to heat stress, being either induced [50,51]
or not induced [23,52]. The response of Hsc70 to cold
stress is poorly documented. In the flesh fly, transcription of Hsc70 is upregulated by cold shock and not by
heat shock [52]. In the rice stem borer, the level of
Hsc70 mRNA decreases slightly during cold acclimation [37]. In mites, the level of Hsc70 transcript is not
changed by heat or cold shock, or by recovery after
either shock [53]. We found that, in D. melanogaster,
cold stress does not modulate the transcriptional
expression of Hsc70-1. Finally, the multicopy gene
Hsp67 is not responsive to cold stress. There are no
data on this gene in the cold stress-related literature.
In Drosophila, expression of Hsp67 is upregulated by
heat stress [32,33]. Therefore, it seems that, unlike the
other Hsp genes tested here, Hsp67 does not respond
similarly to heat and cold stress. The absence of transcriptional change in expression in these three Hsp
genes suggests that they do not contribute to the cold
repair or cold acclimation machinery. However, we
cannot exclude the possibility of potential translational
or post-translational regulation.

Heat shock response to cold stress

tions match that reported in Bettencourt et al. [23], in
the context of heat stress induction in D. melanogaster.
This suggests that thermal stress (heat or cold) triggers
expression changes in the same set of heat shock genes.
However, differences exist between the two responses:
the level of expression is much higher for heat stress,
and the response is also direct, whereas it is delayed
for cold stress. Differences between heat and cold
responses could arise from differential activation of the
various Drosophila heat shock factor (HSF) isoforms
[54] or from incomplete activation of HSFs under cold
stress, as observed under mild heat stress [55].
Upregulation of Hsps may be triggered by various
accumulated chilling injuries [14,56], and there is evidence that Hsps play a role in the repair process in
insects [30]. However, the possibility that the stress
response observed is a result of the activation of hardening ⁄ acclimation mechanisms should also be considered, as both processes involve expression of some Hsps
in Drosophila [40,57]. Finally, it has been suggested that
expression of Hsps during recovery from cold might
result from the thermal stress experienced during the
upshift in temperature [12]. However, other results have
shown that cold itself acts as a cue for the induction
[28]. The maximum expression levels were only attained
when flies were returned to an optimal temperature
(peak after 2 h). The functional explanation for this
delay is unknown, but it may reflect the strong repression of metabolic activity at low temperature.
An additional test was performed to address the
possible repair ⁄ protective function of Hsps during the
recovery phase. On the basis on recovery times
(Fig. 4), flies exposed to constant cold for 16 h were

Functional significance
There are different degrees of cold inducibility in the
D. melanogaster Hsp network. Some genes are only
constitutively expressed, whereas others are constitutively expressed and upregulated after stress or are
exclusively inducible. According to their cold stress
responses, we consider that Hsp60, Hsp67Ba and
Hsc70-1 are not cold-inducible, whereas Hsp22, Hsp23,
Hsp26, Hsp27, Hsp40, Hsp68, Hsp70Aa and Hsp83 are
cold-inducible. Apart from Hsp67Ba, these designa-

Fig. 4. Sigmoid models describing the cumulative proportion of
flies recovering (Y) in relation to time spent after cold stress (X).
Circles: 8 h treatment (i.e. 8 h of cold stress). Squares: 8 + 3 + 8 h
treatment (i.e. two successive cold stresses of 8 h separated by
3 h of recovery). Triangles: 16 h treatment (i.e. 16 h of cold stress).
The equation Y = A ⁄ [1 + 10(log B–X)C] was used to fit the data,and
to estimate the following parameters: A, which represents the plateau; B, which represents the halfway point between the bottom
and the top; and C represents the slope. Adjusted coefficients of
determination (r2) are provided for each group.

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

179

Heat shock response to cold stress

H. Colinet et al.

the most affected (16 h treatment), followed by flies
exposed to cold for 16 h but with an intermediate
pulse of 3 h at 25 C (8 + 3 + 8 h treatment), and
finally, flies exposed to cold for 8 h (8 h treatment)
were the least affected (Fig. 4). With the 16 h treatment, 29% of the flies did not recover at all after
90 min (but were still alive), and parameter B (i.e. the
halfway point between the bottom and the plateau of
the sigmoidal curve) was 51.99 ± 0.38 min. With the
8 + 3 + 8 h treatment, 13% of the flies did not
recover after 90 min (but were still alive), and parameter B was 42.94 ± 0.27 min. Finally all flies of the 8 h
treatment group recovered within 90 min, and parameter B was 31.20 ± 0.21 min. The results suggest that
the short pulse at 25 C, during which some Hsp genes
are highly expressed, allows partial repair of chilling
injuries. Even though flies from the 8 + 3 + 8 h treatment group suffered less than flies from the 16 h treatment group, the beneficial impact of the short pulse at
25 C was not sufficient to completely offset the physiological cost of the first 8 h of cold stress. This short
pulse did not seem to provide any protection, as flies
of the 8 + 3 + 8 h treatment group took longer to
recover than the 8 h treatment flies. In summary, these
results suggest: (a) a possible role of Hsp upregulation
in repair functions, supporting the ideas of Kosˇ ta´l and
Tollarova´-Borovanska´ [30]; and (b) no role of Hsp
upregulation in protective functions, supporting the
ideas of Nielsen et al. [57]. In addition to Hsps, the
expression of other genes, proteins or metabolites
could be regulated during the recovery from cold
[16,19,20], and may be responsible for repair processes
during recovery.
Because flies are immobilized at 0 C (chill coma),
long-term cold stress may damage flies though a combination of temperature and starvation stresses. In
mites, the Hsc70 mRNA level decreases as a result of
food restriction [53]. In Drosophila, Hsp26, Hsp27 and
Hsp70 are upregulated after 58 h of starvation [58].
Sinclair et al. [17] analyzed the response of Hsp70 and
Hsp23 transcripts after a 5 h starvation period, and
neither showed any expression modulation. In our
experimental design, flies were starved at 0 C for 9 h,
and then allowed to recover with or without food for
8 h. Therefore, flies recovering without food experienced a total starvation period of 17 h. We did not
observe any difference between these two conditions in
the expression of the 11 genes analyzed, suggesting
that starvation stress was not severe and ⁄ or long
enough to cause any differential Hsp expression.
The response of D. melanogaster to low temperature
is complex and still not fully understood, despite the
availability of new molecular tools [59]. The current
180

study shows that expression of some, but not all, Hsp
genes is elicited in response to prolonged cold stress.
Some Hsp genes (Hsp22, Hsp27, Hsp40, and Hsp68)
are reported as being cold-inducible for the first time.
Although there is a strong indication that Hsps lead to
cold tolerance [29,30], the functional significance of the
heat shock response for cold stress is not fully understood, especially as protein denaturation is unlikely to
occur at 0 C [14]. Both Hsp70-deficient and HSF-deficient mutant flies maintain some degree of heat tolerance, suggesting that compensatory modification of
other Hsp genes, such as Hsp40, Hsp68, and Hsp83,
may underlie the maintenance of some degree of thermotolerance [22,60]. A key feature of the heat shock
response is its suppression following restoration of
normal environmental conditions [6], because some
Hsps can be detrimental to normal growth [5]. However, we show that, for cold, the stress response is
essentially observed during the recovery phase. This
study provides an overview of the temporal expression
of D. melanogaster Hsp genes in response to cold
stress. As the network of Hsp genes clearly shows species specificity [61], it would be interesting to compare
the stress response of D. melanogaster with other
models. Why cold stress induces the expression of eight
different Hsp genes in D. melanogaster and whether or
not these Hsps have overlapping activities remain open
questions. The use of mutant (e.g. deletion and extra
copy numbers) and transgenic (RNAi and overexpression) lines will help us to better understand the
relationship between Hsps and cold tolerance.

Experimental procedures
Fly culture
We conducted our experiments on a mass-bred D. melanogaster population derived from about 50 females collected
in Innisfail (Australian east coast, 17 33¢S) in May 2008.
Flies were maintained in 250 mL bottles for 15 generations
at 19 C and 70% relative humidity under continuous light
on a medium that contained yeast (3.2% w ⁄ v), agar (3.2%)
and sugar (1.6%) standard fly medium [62]. The fly density
was kept at approximately 500 individuals per bottle. Flies
were transferred at 25 C for three generations at the time
of experiments.

Conditions for cold stress and recovery
Both sex and age can differentially affect cold resistance
and Hsp expression [5]. Therefore, all tests were performed
using synchronized 4-day-old virgin males. CO2 anesthesia
is a standard technique used to sex Drosophila flies. How-

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

H. Colinet et al.

ever, there is increasing evidence that anesthesia interacts
with stress recovery [63]. Therefore, to avoid any potential
confusing effect on Hsp gene expression, all flies were sexed
without CO2 within an 8 h window after eclosion.
For measurement of gene expression during the cold stress
and during the recovery period, groups of 20 males (4 days
old, virgin) were placed in 42 mL glass vials (without food),
which were immersed in a 10% glycol solution cooled to
0 C to induce chill coma. Flies were sampled after 0.25, 3, 6
and 9 h of cold stress, denoted as S025, S3, S6, and S9,
respectively (Fig. 1). Preliminary experiments were performed to determine stress durations at low temperature that
were not associated with mortality. To ensure that gene
expression was not confounded by nutritional effects during
recovery (i.e. flies refeeding after cold-induced starvation),
mRNA expression was compared in flies recovering with or
without food. After 9 h of cold stress, flies were returned to
25 C to recover, and randomly divided into two groups:
recovery with food (RF), or recovery with agar (RA)
(Fig. 1). Flies of the RF group were placed in vials with
10 mL of standard food medium. Flies of the RA group
were transferred to vials containing 10 mL of 1% agar,
which provides a source of water but not nutrients. For
determination of any cumulative patterns of gene expression
during the recovery period, samples were taken after 0.5, 2, 4
and 8 h during recovery (i.e. R05F, R2F, R4F and R8F with
food, and R05A, R2A, R4A and R8A with agar only)
(Fig. 1). For every sampling time, there was a corresponding
control, consisting of males kept at 25 C for the same period
of time (Fig. 1). For each treatment–duration combination,
four vials (20 males each) were used for molecular analysis.
At each specific sampling time, flies were directly transferred
into 2 mL screwcap storage tubes, snap-frozen in liquid
nitrogen, and stored at )80 C until RNA extraction.
In order to detect the cumulative effect of low temperature on the time required to recover, we used the method
described in Hoffmann et al. [64]. Briefly, for each cold
stress duration (i.e. 0.25, 3, 6 and 9 h), 40 males were
allowed to recover at 25 C, and the recovery time was
recorded. Flies were considered to have recovered when
they stood up.

RNA extraction and reverse transcription
Flies were ground to fine powder in 1.5 mL tubes placed in
liquid nitrogen. Samples were mixed with 600 lL of lysis
buffer (containing 1% b-mercaptoethanol) from RNeasy
RNA extraction kits (Qiagen Pty, Doncaster, Australia) and
vortexed for 3–5 min to complete homogenization. RNA
extraction and purification was performed using an RNeasy
spin column (Qiagen), following the manufacturer’s instructions. Optional on-column DNase digestion was performed
to remove any potential genomic DNA contamination, using
an RNase-Free DNase Set (Qiagen). Total RNA was eluted
in 30 lL of diethylpyrocarbonate-treated water. RNA was

Heat shock response to cold stress

quantified and quality-checked with a UV spectrophotometer
(Gene Quant Pro, Amersham Bioscience, Analytical Instruments, Golden Valley, MN, USA) (criteria: A260 nm ⁄ A230 nm
> 1.85; A280 nm ⁄ A260 nm > 1.85). The integrity of RNA (i.e.
the presence of twp intense rRNA bands) was examined by
running 1 lL of each RNA sample on a 1% agarose gel. Only
samples that satisfied both the quality and integrity requirements were used in subsequent experiments. Four highquality RNA samples (i.e. biological replicates) were
obtained for each condition except for SO25, S6, R2F, R4F,
R8F, and R8A, which had three biological replicates.
Three hundred nanograms of total RNA was used in the
reverse transcription to cDNA, using the Superscript III
First-Strand Synthesis System for qRT-PCR (Invitrogen
Pty, Thornton, Australia), according to the manufacturer’s
instructions. The cDNA was diluted 10-fold in diethylpyrocarbonate-treated water, and stored at )20 C until use.

Real-time PCR
The coding sequences of the Hsp genes were retrieved from
Flybase (http: ⁄ ⁄ flybase.org ⁄ ), and primers were designed
using the primer3 module in biomanager (http: ⁄ ⁄ www.
angis.org.au) (see Table 1 for details). For genes with multiple transcripts, only sequences common to all transcripts
were considered. We performed electronic PCR for all
primer pairs on the reference D. melanogaster genome to
check for primer specificity (http: ⁄ ⁄ www.ncbi.nlm.nih.gov ⁄
tools ⁄ primer-blast ⁄ ).
Real-time PCRs were performed on the LightCycler 480
system. Reactions were performed in 384-well LightCycler
plates, using LightCycler 480 High Resolution Melting Master Mix (Roche Diagnostics Pty, Castle Hill, Australia), and
the crossing point (Cp), equivalent to the cycle threshold
(Ct), estimates were obtained using the absolute quantification module in the software package. The PCR reactions
were performed in a final volume of 10 lL containing 1 lL
of cDNA sample, 0.4 lm each primer, and 5 lL of the 2·
High Resolution Melting Master Mix. After 10 min at
95 C, the cycling conditions were as follows: 60 cycles at
95 C for 10 s, 60 C for 15 s, and 72 C for 15 s. To validate the specificity of amplification, a postamplification melt
curve analysis was performed. Amplicons were first denatured at 95 C for 1 min, and then cooled to 65 C, and the
temperature was then gradually raised to 95 C in increments of 0.02 CÆs)1. Fluorescence data were recorded continuously during this period, and subsequently analyzed
using the Tm calling module in the LightCycler 480 software.
Ratio ¼
ðcontrol treatedÞ

ðEtarget ÞDCp target

ðcontrol treatedÞ

=ðEreference ÞDCp reference

ð1Þ

Relative expression ratios (i.e. fold change) were calculated using the efficiency calibrated model of Pfaffl [65],

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS

181

Heat shock response to cold stress

H. Colinet et al.

rather than the classic 2)DDCt method, which assumes optimal and identical amplification efficiencies in target and reference genes. In the Pfaffl model (Eqn 1), Cp is the crossing
point (i.e. Ct) and E the efficiency of PCRs. The ratio of
the target gene is expressed in treated samples versus
matched controls (calibrators), and normalized using the
housekeeping reference gene. We used RpS20 as reference
[66] instead of actin, because cytoskeletal structures are
thermally labile in insects [19,45]. To demonstrate stability
of the RpS20 transcripts within and between thermal treatments, the expression of RpS20 was standardized relative to
another D. melanogaster housekeeping gene (DmRP140)
[67], and analyzed using one-way ANOVA. Because amplification efficiency may not be exactly 100%, accurate determination of ratios requires the estimation of efficiency [65],
preferably for every reaction [68]. We used a noiseresistant iterative nonlinear regression algorithm (realtime pcr miner; http: ⁄ ⁄ www.miner.ewindup.info ⁄ ) to
determine the efficiency of every individual reaction. It has
been established that this method provides the best precision for real-time PCR efficiency estimation [68,69].

Additional test
To address the functional role of Hsps during the recovery
phase, we compared the time to recovery of flies exposed to
three different cold stress treatments: constant 0 C for 8 h
(8 h treatment), or 0 C for 8 h followed by 3 h of recovery
at 25 C and then another 8 h at 0 C (8 + 3 + 8 h treatment), or constant 0 C for 16 h (16 h treatment). In the
8 + 3 + 8 h treatment, flies experienced a total cold stress
duration of 16 h, but the short pulse at 25 C allows the
upregulation of Hsp genes (as observed in the present
study). All flies used were 4-day-old males, as described
previously. The hypotheses advanced were as follow. If
expression of Hsp genes during recovery has a repair function, the recovery time should be less after the
8 + 3 + 8 h treatment than after the 16 h treatment. The
Hsp induction requires exposure to a rather long period of
cold stress [12]. If this cold stress period has no physiological cost, because of complete repair during the recovery,
the time to recover should be similar after the 8 h and the
8 + 3 + 8 h treatments. Finally, if the induction of Hsp
genes during recovery has a protective function, the recovery time after the 8 + 3 + 8 h treatment should be less
than after the 8 h treatment. We used 45 flies in each
group, and recovery times were recorded at 25 C over a
maximum period of 90 min (as described before). The proportion of flies that had recovered was cumulated over
time, giving a sigmoid-shaped function. A nonlinear regression method (i.e. Eqn 2) was used to fit the relationship
between the dependent variable Y (cumulative percentage
of recovery) and the independent variable X (time after cold
stress). In Eqn (2), the parameter A estimates the plateau,

182

B the halfway point between the bottom and the top, and
C the slope:
Y ¼ A=ð1 þ 10ðlog B XÞC Þ

ð2Þ

Acknowledgements
We are grateful to L. Rako, J. Shirriffs, S. de Garis,
A. Rako, L. Carrington, K. Mitchell and M. Telonis
for assistance with fly work. This study was supported
by ‘Fonds de la Recherche Scientifique – FNRS’, the
Australian Reseach Council, and the Commonwealth
Environmental Research Fund. This paper is number
BRC 148 of the Biodiversity Research Centre.

References
1 Sinclair BJ, Vernon Ph, Klok CJ & Chown SL (2003)
Insects at low temperatures: an ecological perspective.
Trends Ecol Evol 18, 257–262.
2 Feder ME & Hofmann GE (1999) Heat-shock proteins,
molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu Rev Physiol 6,
243–282.
3 Hoffmann AA, Sørensen JG & Loeschcke V (2003)
Adaptation of Drosophila to temperature extremes:
bringing together quantitative and molecular
approaches. J Therm Biol 28, 175–216.
4 Frydenberg J, Hoffmann AA & Loeschcke V (2003)
DNA sequence variation and latitudinal associations in
hsp23, hsp26 and hsp27 from natural populations of
Drosophila melanogaster. Mol Ecol 12, 2025–2032.
5 Sørensen JG, Kristensen TN & Loeschcke V (2003) The
evolutionary and ecological role of heat shock proteins.
Ecol Lett 6, 1025–1037.
6 Parsell DA & Lindquist S (1993) The function of
heat-shock proteins in stress tolerance: degradation and
reactivation of damaged proteins. Annu Rev Genet 27,
437–496.
7 Hoffmann AA & Parsons PA (1991) Evolutionary
Genetics and Environmental Stress. Oxford University
Press, New York.
8 Tammariello SP, Rinehart JP & Denlinger DL (1999)
Desiccation elicits heat shock protein transcription in
the flesh fly, Sarcophaga crassipalpis, but does not
enhance tolerance to high or low temperatures. J Insect
Physiol 45, 933–938.
9 Al-Fageeh MB & Smales CM (2006) Control and regulation of the cellular responses to cold shock: the
responses in yeast and mammalian systems. Biochem J
397, 247–259.
10 Norry FM, Gomez FH & Loeschcke V (2007) Knockdown resistance to heat stress and slow recovery from
chill coma are genetically associated in a central region

FEBS Journal 277 (2010) 174–185 ª 2009 The Authors Journal compilation ª 2009 FEBS


Related documents


2010 colinet hoffmann ibmb
2010 colinet et al febs
2010 colinet et al plos one
2010 colinet et al jeb
2012 colinet hoffmann funct ecol
2013 colinet et al jeb


Related keywords