2014 Overgaard et al JIP.pdf


Preview of PDF document 2014-overgaard-et-al-jip.pdf

Page 1 2 3 4 5 6 7 8

Text preview


48

J. Overgaard et al. / Journal of Insect Physiology 62 (2014) 46–53

(Biorad, Marnes-la-Coquette, France) according to the manufacturer’s instructions. 2D-DIGE experiment was performed as previously described (Colinet et al., 2013). Briefly, 50 lg of protein
extracts from individual biological replicates of control at 25 °C
and RCH phenotypes were labeled with 400 pmol of cyanine dyes
Cy3 or Cy5 (GE Healthcare, Orsay, France), in a reciprocal manner
(i.e. dye swapping) according to a standardized protocol (Com
et al., 2011). The isoelectric focusing (IEF), strip equilibration and
electrophoresis were performed using exactly the same conditions
as previously reported (Colinet et al., 2013). After electrophoresis,
gels were scanned at a resolution of 200 lm (pixel size) using a
Typhoon™ 9400 imager (GE Healthcare). The image analysis was
performed using the DeCyder software (version 5.01) with a
P 6 0.01 (Student’s t-test) threshold for the selection of differentially modulated spots between RCH and 25 °C control. For each
protein, a mean fold change (normalized abundance of RCH over
25 °C) based on the four replicate gels was calculated using the
DeCyder software. All matched proteins were ranked in a volcano
plot according to their statistical P-value and their fold change.
Four hundred micrograms of a mix of protein extracts from all analyzed samples (i.e. internal standard) were loaded on a preparative
gel that was run and analyzed together with the analytical gels.
This preparative gel was stained with LavaPurple and the images
were matched against the spots referenced. The picking list was
exported to Screen Picker (Proteomics Consult, Kampenhout, Belgium) for spot picking. In gel digestion was performed as previously described (Colinet et al., 2013) and tryptic peptides were
then analyzed by nano-LC-MS/MS using nano-LC system Ultimate
3000™ (DIONEX – LC Packings, Amsterdam, The Netherlands)
coupled on-line to a linear ion trap HCT Ultra P™ Discovery
system mass spectrometer (BrukerDaltoniK, GmBh, Germany)
(see Colinet et al., 2013 for experimental settings). MS/MS data
files were processed using the DataAnalysissoftware (version 3.4;
BrukerDaltoniK, GmBh, Germany). The proteinScape 2.1 software
(BrukerDaltonik GmbH) was then used to submit MS/MS data to
the following database: NCBI restricted to Drosophila (June 2011,
223543 sequences) using the Mascot search engine (Mascot server
v2.2; http://www.matrixscience.com). Search parameters were set
as previously (Colinet et al., 2013) and peptide identifications were
accepted if the individual ion Mascot scores were above the identity threshold.
2.6. Gene expression (qPCR)
Gene expression was investigated in four replicates each based
on 15 flies each and run on a Stratagene MX3005P (AH Diagnostics,
Aarhus, Denmark). All procedures and reagents were as described
in (Colinet et al., 2013). The gene investigated in this study was glycogen phosphorylase (GlyP) (Accession No. FBtr0077828, primers,
forward: CCATGTTCGACATTCAGGTG, reverse: TGGGATCCTTCTTGATCCTG). The data presented here was part of a larger data set
comprising 9 genes of which another part is published in (Colinet
et al., 2013) allowing the gene expression data to be normalized
using the algorithm NORMA-gene, which calculates a normalization factor without the use of reference genes (Heckmann et al.,
2011).
2.7. Cryoprotective sugars
Dry mass after flies had been dried at 60 °C for 24 h was measured before extraction. Cryoprotective sugars were extracted from
10 individuals/sample by steel bead homogenization in 0.5 ml 70%
ethanol using a TissueLyser II (Qiagen, Copenhagen, Denmark) at
30 Hz for 2  15 s. The supernatant was transferred to a glass centrifuge vial and the extraction vial was rinsed with another 0.5 ml
ethanol to washout remaining sample. Samples were then

evaporated to dryness under nitrogen flow at room temperature
(approximately 90 min) after which they were silylated by adding
900 ll pyridine, 90 ll hexamethyldisilazane (HMDS), and 10 ll
chlorotrimethylsilane (TMCS) and incubated for 2 h in darkness
at room temperature. Samples were centrifuged and the supernatant was transferred to autosampling vials before the GC–MS analysis. Samples of 2 ll were injected in split mode (split ratio 1:5) at
260 °C and the oven was programmed to hold the temperature at
120 °C for 2 min, then increase to 280 °C in steps during a period
of 20 min. Column flow was 0.6 ml min1 at a pressure of
210 kPa. The GC/MS inter-phase temperature was 200 °C, and the
ion source temperature was 220 °C. The mass spectrometer was
operated in the electron ionization mode. Resulting chromatograms were analysed by the GC–MS software and sugars were
identified and quantified based on standard curves of known
sugars.
2.8. Measurement of glycogen phosphorylase activity
From each time point and each treatment group (RCH and control) we used 5–6 replicates of 10 flies for measurement of glycogen phosphorylase (GlyP) activity. Flies were placed in a 2 ml
eppendorf tube with 0.5 ml of homogenization buffer consisting
of 50 mM Imidazole (pH 7.5); 100 mM NaF; 5 mM ethylene glycol
tetraacetic acid; 1 mM phenylmethylsulfonyl fluoride (protease
inhibitor); 15 mM 2-mercaptoethanol; 0.02% bovine serum albumin and 50% glycerol. The sample was homogenized at 5 °C using
a TissueLyserLT (Qiagen, Copenhagen, Denmark) at 50 Hz for
12  30 s with 30 s on ice between rounds. The homogenate was
centrifuged for 10 min at 5 °C (7000g), and the supernatant transferred to an eppendorf tube for storage at 80 °C until enzymatic
activity was measured.
GP activity was measured spectrophotometrically in a reaction
buffer similar to the protocol described by Koštál et al. (2004). The
reaction buffer contained 56 mM phosphate buffer (pH 6.8);
2.2 mg/mL glycogen; 1.5 mM MgCl2; 0.1 mM EDTA; 3.75 lg/ml
glucose-1.6-diphosphate and 0.5 mM nicotinamide adenine dinucleotide phosphate. Before measurements we added phosphoglucomutase (EC 5.4.2.2) and glucose-6-phosphate dehydrogenase
(nicotinamide adenine-dinucleotide phosphate dependent) (EC
1.1.1.49) to a final concentration of 0.2 U/ml in a total of 1040 ll
of reaction buffer. Following baseline recording of absorbance we
added 20 ll of sample and measured the subsequent change in
absorbance over a 30 min period. The activity of the activated glycogen phosphorylase a (GlyPa) was measured without addition of
50 adenosine monophosphate to the reaction buffer while the total
GP pool (GlyPtotal) was measured by adding 2-mM 50 AMP to the
reaction buffer. Enzymatic activity is reported in Units/min (moles
of substrate converted per minute) and all values are reported relative to measured activity of standards (bovine GlyP) with known
activity (U/ml).
2.9. Statistical analysis
T-tests were used to test for differences with respect to cold
survival and fecundity during cold recovery. Differences in sugar
concentrations, GlyP activity and gene expression levels were
tested with two-way ANOVAs with time (0, 2 and 6 h) and treatment (RCH vs. control) as fixed factors with accompanying post
hoc pairwise comparisons (Bonferroni t-tests). In cases where normality and equal variance could not be verified we employed standard non-parametric tests (Kruskal–Wallis). All statistical tests
were performed using Sigmaplot software. Data are presented as
mean ± standard error and differences are considered significant
at the P < 0.05 level.