Appendix 1 thesis.pdf


Preview of PDF document appendix-1-thesis.pdf

Page 1...4 5 678368

Text preview


2/11/2016

NCBI Blast:c2
partial sequence
Astragalus jaegerianus voucher ASJA­1
tRNA­Leu (trnL) gene, partial sequence;
and trnL­trnF intergenic spacer, complete
sequence; chloroplast

104

104

100%

2e­19

88%

DQ403845.1

Lycium ruthenicum chloroplast trnL (UAA)
gene, intron sequence

104

104

100%

2e­19

90%

AB036585.1

Astragalus nothoxys chloroplast tRNA­Leu
(trnL) gene, intron sequence

104

104

100%

2e­19

89%

AF126979.1

Astragalus arizonicus chloroplast tRNA­Leu
(trnL) gene, intron sequence

104

104

100%

2e­19

89%

AF126973.1

Astragalus pehuenches chloroplast tRNA­
Leu (trnL) gene, intron sequence

104

104

100%

2e­19

89%

AF126972.1

Medicago papillosa chloroplast, complete
genome

102

102

100%

8e­19

84%

KJ850241.1

Medicago hybrida chloroplast, complete
genome

102

102

100%

8e­19

84%

KJ850240.1

Lathyrus inconspicuus chloroplast,
complete genome

102

102

100%

8e­19

84%

KJ850236.1

Ipomoea batatas cultivar Xushu 18
chloroplast, complete genome

102

102

100%

8e­19

90%

KP212149.1

Lathyrus crassipes isolate P025 tRNA­Leu
(trnL) gene, partial sequence; chloroplast

102

102

100%

8e­19

84%

KP057648.1

Alignments
Vicia faba isolate 7612 tRNA­Leu (trnL) gene, partial sequence; chloroplast
Sequence ID: gb|KJ787213.1| Length: 487 Number of Matches: 1
Range 1: 83 to 159
Score

Expect

Identities

Gaps

Strand

134 bits(148)

1e­28()

76/77(99%)

0/77(0%)

Plus/Plus

Frame

Features:
Query  1    GGCAATCCTGAGCCAAATCCTTCTTTCCaaaaacaaaaaactaaaagttcagaaaaaaaG  60 
            |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| 
Sbjct  83   GGCAATCCTGAGCCAAATCCTTCTTTCCGAAAACAAAAAACTAAAAGTTCAGAAAAAAAG  142 
Query  61   GATAGGTGCAGAGACTC  77 
            ||||||||||||||||| 
Sbjct  143  GATAGGTGCAGAGACTC  159 

Vicia faba plastid, complete genome
Sequence ID: gb|KF042344.1| Length: 123722 Number of Matches: 1
Range 1: 118542 to 118618
Score

Expect

Identities

Gaps

Strand

134 bits(148)

1e­28()

76/77(99%)

0/77(0%)

Plus/Plus

Frame

Features:
Query  1       GGCAATCCTGAGCCAAATCCTTCTTTCCaaaaacaaaaaactaaaagttcagaaaaaaaG  60 
               |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| 
Sbjct  118542  GGCAATCCTGAGCCAAATCCTTCTTTCCGAAAACAAAAAACTAAAAGTTCAGAAAAAAAG  118601 
Query  61      GATAGGTGCAGAGACTC  77 
               ||||||||||||||||| 
Sbjct  118602  GATAGGTGCAGAGACTC  118618 

Vicia faba isolate HS879 tRNA­Leu (trnL) gene and trnL­trnF intergenic spacer, partial sequence; chloroplast
Sequence ID: gb|JX505737.1| Length: 604 Number of Matches: 1
Range 1: 66 to 142
Score

Expect

Identities

Gaps

Strand

134 bits(148)

1e­28()

76/77(99%)

0/77(0%)

Plus/Plus

Frame

Features:
Query  1    GGCAATCCTGAGCCAAATCCTTCTTTCCaaaaacaaaaaactaaaagttcagaaaaaaaG  60 
            |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| 
Sbjct  66   GGCAATCCTGAGCCAAATCCTTCTTTCCGAAAACAAAAAACTAAAAGTTCAGAAAAAAAG  125 
http://blast.ncbi.nlm.nih.gov/Blast.cgi

6/7