PDF Archive

Easily share your PDF documents with your contacts, on the Web and Social Networks.

Send a file File manager PDF Toolbox Search Help Contact



Guineafowls .pdf



Original filename: Guineafowls.pdf
Title: Melanism in guinea fowl (Numida meleagris) is associated with a deletion of Phenylalanine256 in the MC1R gene

This PDF 1.3 document has been generated by Arbortext Advanced Print Publisher 9.0.114/W / PDFlib PLOP 2.0.0p6 (SunOS)/Acrobat Distiller 7.0 (Windows), and has been sent on pdf-archive.com on 23/02/2016 at 10:09, from IP address 149.156.x.x. The current document download page has been viewed 430 times.
File size: 146 KB (3 pages).
Privacy: public file




Download original PDF file









Document preview


SHORT COMMUNICATION

doi:10.1111/j.1365-2052.2010.02056.x

Melanism in guinea fowl (Numida meleagris) is associated
with a deletion of Phenylalanine-256 in the MC1R gene
O. Vidal, R. M. Araguas, R. Ferna´ndez, S. Heras, N. Sanz and C. Pla
Departament de Biologia, Universitat de Girona, E-17071 Girona, Catalonia, Spain

Summary

We have characterized a deletion in the MC1R gene causing the loss of one amino acid
(p.Phe256del), which is perfectly associated with melanism in guinea fowl (Numida meleagris). Co-segregation of the p.Phe256del with melanism was confirmed in 25 offspring
born from a cross of two heterozygote birds; therefore we suggest that this mutation is
responsible for the black phenotype. Interestingly, this is the first case of recessive melanism
linked to MC1R.
Keywords guinea fowl, MC1R, melanism.

The genetic basis of melanic phenotypes has been described
in a variety of mammals and birds, including domestic
(Kijas et al. 1998; Kerje et al. 2003) and wild species
(Theron et al. 2001; Nachman et al. 2003). With some
exceptions, melanism usually involves the MC1R locus,
which encodes the melanocortin 1 receptor (Majerus &
Mundy 2003; Mundy 2005). The MC1R protein is a
transmembrane G-protein coupled receptor and plays a key
role in the regulation of the eumelanin/phaeomelanin
synthesis pathway, a metabolic route producing both red/
yellow and black phenotypes (Jackson 1997). In birds,
several mutations causing melanism have been described,
including coincident amino acid changes in chicken (Kerje
et al. 2003), Japanese quail (Nadeau et al. 2006) and
bananaquit (Theron et al. 2001).
In guinea fowl (Numida meleagris), the wild phenotype is
characterized by blue-grey feathers with white dots. Several
variations of this pattern exist, including lighter (lavender)
and darker or melanic (purple) forms, both of which are
inherited as autosomal recessive traits (Fig. 1). While the
lavender coloration has been associated with the lilac
mutation of the melanophilin (MLPH) locus (Burke et al.
2007), there is no information about the melanic plumage,
although MC1R is an obvious candidate.
Initially, 8 guinea fowls were analyzed: 3 animals with
wild-type plumage, 2 with the lavender phenotype (belonging
to an inbred population with no melanic individuals), and 3
individuals showing melanism. Genomic DNA from feathers
Address for correspondence
O. Vidal, Departament de Biologia, Universitat de Girona, E-17071
Girona, Catalonia, Spain.
E-mail: oriol.vidal@udg.cat
Accepted for publication 1 March 2010

656

was extracted with ChelexR 100 Resin (Bio-rad) to amplify a
fragment of 1101 bp of the MC1R gene with primers
MSHR78R (CAGGAGCACAGCACCACCTC) (Nadeau et al.
2007) and MC1R5F1 (CAGCCAGGGGYCCYGGGG). Primer
MC1R5F1 was designed by aligning MC1R sequences of
Coturnix japonica – GenBank AB201632.1–, Gallus gallus –
GenBank AB201630.1– and Corvus corone – GenBank
EU348730.1–. Additionally, primer MC1R3R1 (TGCAAAG
AGCCTTTATT) and primer MC1RF2NM (GGACCGCTA
CATCACCATCT) were designed to amplify the remaining
coding region. Primer MC1RF2NM was designed from the
obtained Numida sequences, while for the MC1R3R1 primer
the MC1R downstream sequence of Gallus gallus –ENSEMBL
ENSGALG00000023459- was used as a template. In all
cases, amplification reactions had 1.5 mM MgCl2, 200 lM
dNTPs, 0.2 lM of each primer, 25 ng of genomic DNA and
0.3 U Taq DNA polymerase (Ecogen S.R.L.) in a final 30 ll
volume. The thermal profile was 94ºC 5 min followed by 35
cycles of 94ºC 30 s, 60ºC 1 min and 30 s and 72ºC 1 min
and 30 s. PCR products were purified with the illustraTM GFX
PCR DNA and Gel Band Purification kit (GE Healthcare) and
sequenced with the BigDyeÒ Terminator v3.1 Cycle
Sequencing kit (Applied Biosystems) using both PCR primers.
Sequences were aligned with Multalin software (Corpet
1988).
This analyzed fragment includes the whole coding region
(942 bp) of MC1R. The alignment of the eight guinea fowl
sequences revealed only one polymorphism (c.780_782
delTTC), a three-nucleotide deletion that causes the loss of
one phenylalanine (p.Phe256del) located in the transmembrane region 6 (Prusis et al. 1997). This polymorphism
generates two different alleles: GQ449249 (from now on,
wild) and GQ449248 (with the deletion; from now
on, mutant). Remarkably, we found a perfect association

Ó 2010 The Authors, Animal Genetics Ó 2010 Stichting International Foundation for Animal Genetics, 41, 656–658

A MC1R mutation is associated with melanism in guinea fowl
(a)

(b)

(c)

Figure 1 (a) Wild, (b) melanic and (c) lavender
plumages of Numida meleagris.

between genotype and plumage phenotype: the three
melanic guinea fowls were homozygote for the mutant
allele, while all the other animals bore at least one copy of
the wild allele. Two wild-type individuals were heterozygote;
the third one and the two lavender fowls were homozygote
for the wild allele.
To further confirm the association between the
p.Phe256del and melanism, we analyzed the co-segregation
of the two alleles with the trait in 25 individuals born from a
cross of the two previously analyzed heterozygote animals,
both showing the wild-type phenotype. As a genotyping
protocol, we designed two primers, MC1RF1NM (GGACC
GCTACATCACCATCT) and MC1RR1NM (TGAAGAAGCAG
GTGCAGAAA) to specifically amplify a small fragment of
410 bp including the deletion point. Genomic DNA extraction, PCR conditions and thermal profile are the same as
described above; primer MC1RF1NM was fluorescently
labeled so the amplified products could be directly analyzed
in an automatic sequencer, the ABI PRISMÒ 3130 Genetic
Analyzer (Applied Biosystems).
Again, results showed full concordance between genotypes and phenotypes. Of the 25 keets, seven showed the
melanic phenotype and were homozygote for the mutant
allele. Eighteen had the wild-type plumage, and were either
heterozygote (9) or homozygote for the wild allele (9). As
expected, the association between genotypes and phenotypes is highly significant (P < 0.001, FisherÕs exact test).
Interestingly, this is the first reported case of recessive
melanism attributable to MC1R, and, in birds, this is the
first time melanism has been associated with a deletion
in the coding sequence of the MC1R gene. Moreover, the
location of the mutation in transmembrane region 6 is far
from any other functional mutation known in mammals or
birds (Majerus & Mundy 2003).
We used the Polyphen tool (http://genetics.bwh.
harvard.edu/pph) to evaluate the consequences of the deletion. The prediction obtained, based on multiple alignments,
suggests no damaging effects, and the mutation is considered
benign. In previously reported effects of MC1R, deleterious
or loss-of-function mutations are related to an exclusive
production of phaeomelanin, and therefore, to recessive red/
yellow color variations. In contrast, dominant dark phenotypes are related to gain-of function mutations (Rees 2000),
which can increase eumelanin synthesis. In this sense,
several mutations in the coding region of the MC1R gene

have been demonstrated to cause constitutive activation of
the receptor and thus dominant melanic phenotypes in
chicken and mouse (Robbins et al. 1993; Ling et al. 2003).
However, in Japanese quail, a melanic phenotype caused by a
MC1R mutation which shows dominant inheritance in
chicken (p.Glu92Lys) is inherited as an incomplete dominant
trait (Nadeau et al. 2006). The existence of this phenotype
suggests other mechanisms besides constitutive activation,
altering (but not inhibiting) the function of the receptor. The
predicted modification of the Numida protein caused by
p.Phe256del would be compatible with such effects, and
could be linked to a recessive form of melanism.
This association detected between melanism and the
three-nucleotide deletion could be caused by linkage disequilibrium with some other polymorphism(s) nearby that
may be responsible for the actual phenotype. However, it
seems reasonable to suspect that the detected deletion is
really causing the so called purple coloration in N. meleagris.
First, MC1R has been repeatedly reported to influence
melanism in multiple species, including birds (Mundy et al.
2003; Nadeau et al. 2007); second, until now all the
melanic phenotypes described in birds have been associated
with changes in the coding region (Mundy 2005; Nadeau
et al. 2006), which we have sequenced entirely; and third,
the predicted effects of p.Phe256del are compatible to the
phenotype. It is worth mentioning, too, that in-frame deletions have been already associated with melanic phenotypes
in jaguars, jaguarundis (Eizirik et al. 2003) and gray
squirrels (McRobie et al. 2009).
To explain this putative effect of the deletion, two main
mechanisms could be suggested, involving the a-melanocyte stimulating hormone (a-MSH) and the agouti signaling
protein (ASIP), which are an agonist and an antagonist of
MC1R, respectively (Lu et al. 1994). Hypothetically, either
MC1R affinity to a-MSH is increased or the binding of ASIP
to this receptor is hindered. In both cases, the final result
would be a higher production of eumelanin, through an
increased activation (a-MSH hypothesis) or a lack of
repression (ASIP hypothesis) of the receptor.
Interestingly, this melanic phenotype of N. meleagris is
truly shown in adults, while in keets some white patches
expand from the ventral line. In mice and pig, such banded
(or black-and-tan) phenotypes have been associated with
the ASIP gene (Bultman et al. 1992; Drogemuller et al.
2006). Thus, we propose that p.Phe256del alters the

Ó 2010 The Authors, Animal Genetics Ó 2010 Stichting International Foundation for Animal Genetics, 41, 656–658

657

658

Vidal et al.
binding affinity of the MC1R to ASIP, which leads to melanism in adults and to a white-bellied-like pattern in juveniles, although it is not clear why such a mechanism would
lead to a recessive phenotype.

Acknowledgements
We thank Ramon Vidal (Can Baldiret, Sant Gregori) for
taking care of the guinea fowl, collecting samples and giving
useful advice.

References
Bultman S.J., Michaud E.J. & Woychik R.P. (1992) Molecular
characterization of the mouse agouti locus. Cell 71, 1195–204.
Burke T., Vaez M., Johns S. & Tixier-Boichard M. (2007) Convergent evolution of plumage polymorphism in domestic birds: the
lavender phenotype. European Society for Evolutionary Biology,
Abstracts of 11th Congress, 14.
Corpet F. (1988) Multiple sequence alignment with hierarchical
clustering. Nucleic Acids Research 16, 10881–90.
Drogemuller C., Giese A., Martins-Wess F., Wiedemann S.,
Andersson L., Brenig B., Fries R. & Leeb T. (2006) The mutation
causing the black-and-tan pigmentation phenotype of Mangalitza
pigs maps to the porcine ASIP locus but does not affect its coding
sequence. Mammalian Genome 17, 58–66.
Eizirik E., Yuhki N., Johnson W.E., Menotti-Raymond M., Hannah
S.S. & OÕBrien S.J. (2003) Molecular genetics and evolution of
melanism in the cat family. Current Biology 13, 448–53.
Jackson I.J. (1997) Homologous pigmentation mutations in human,
mouse and other model organisms. Human Molecular Genetics 6,
1613–24.
Kerje S., Lind J., Schutz K., Jensen P. & Andersson L. (2003) Melanocortin 1-receptor (MC1R) mutations are associated with
plumage colour in chicken. Animal Genetics 34, 241–8.
Kijas J.M., Wales R., Tornsten A., Chardon P., Moller M. &
Andersson L. (1998) Melanocortin receptor 1 (MC1R) mutations
and coat color in pigs. Genetics 150, 1177–85.
Ling M.K., Lagerstrom M.C., Fredriksson R., Okimoto R., Mundy
N.I., Takeuchi S. & Schioth H.B. (2003) Association of feather
colour with constitutively active melanocortin 1 receptors in
chicken. European Journal of Biochemistry 270, 1441–9.

Lu D., Willard D., Patel I.R. et al. (1994) Agouti protein is an
antagonist of the melanocyte-stimulating-hormone receptor.
Nature 371, 799–802.
Majerus M.E. & Mundy N.I. (2003) Mammalian melanism: natural
selection in black and white. Trends in Genetics 19, 585–8.
McRobie H., Thomas A. & Kelly J. (2009) The genetic basis of
melanism in the gray squirrel (Sciurus carolinensis). Journal of
Heredity 100, 709–14.
Mundy N.I. (2005) A window on the genetics of evolution: MC1R
and plumage colouration in birds. Proceedings of the Royal Society
B: Biological Sciences 272, 1633–40.
Mundy N.I., Kelly J., Theron E. & Hawkins K. (2003) Evolutionary
genetics of the melanocortin-1 receptor in vertebrates. Annals of
the New York Academy of Sciences 994, 307–12.
Nachman M.W., Hoekstra H.E. & DÕAgostino S.L. (2003) The
genetic basis of adaptive melanism in pocket mice. Proceedings of
the National Academy of Sciences of the United States of America
100, 5268–73.
Nadeau N.J., Minvielle F. & Mundy N.I. (2006) Association of a
Glu92Lys substitution in MC1R with extended brown in Japanese
quail (Coturnix japonica). Animal Genetics 37, 287–9.
Nadeau N.J., Burke T. & Mundy N.I. (2007) Evolution of an avian
pigmentation gene correlates with a measure of sexual selection.
Proceedings of the Royal Society B: Biological Sciences 274, 1807–
13.
Prusis P., Schioth H.B., Muceniece R., Herzyk P., Afshar M., Hubbard R.E. & Wikberg J.E. (1997) Modeling of the three-dimensional structure of the human melanocortin 1 receptor, using an
automated method and docking of a rigid cyclic melanocytestimulating hormone core peptide. Journal of Molecular Graphics
and Modelling 15, 307–17, 334.
Rees J.L. (2000) The melanocortin 1 receptor (MC1R): more than
just red hair. Pigment Cell Research 13, 135–40.
Robbins L.S., Nadeau J.H., Johnson K.R., Kelly M.A., RoselliRehfuss L., Baack E., Mountjoy K.G. & Cone R.D. (1993) Pigmentation phenotypes of variant extension locus alleles result
from point mutations that alter MSH receptor function. Cell 72,
827–34.
Theron E., Hawkins K., Bermingham E., Ricklefs R.E. & Mundy N.I.
(2001) The molecular basis of an avian plumage polymorphism
in the wild: a melanocortin-1-receptor point mutation is perfectly
associated with the melanic plumage morph of the bananaquit,
Coereba flaveola. Current Biology 11, 550–7.

Ó 2010 The Authors, Animal Genetics Ó 2010 Stichting International Foundation for Animal Genetics, 41, 656–658


Guineafowls.pdf - page 1/3
Guineafowls.pdf - page 2/3
Guineafowls.pdf - page 3/3

Related documents


PDF Document guineafowls
PDF Document genetic risk african american
PDF Document genetic influence adoptees
PDF Document evidence for evolution in response to natural selection
PDF Document pharmacogenomics education
PDF Document 2012 colinet et al funct ecol


Related keywords