
PDF Archive search engine
Last database update: 14 April at 18:44 - Around 76000 files indexed.

Show results per page

Results for «reverse»:

Total: 800 results - 0.065 seconds

Reversing Stats 100%

Reverse Accident Statistics Statistics from show that:


Stock List May 22nd 99%

Model iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 32GB iPhone 5S 32GB iPhone 5S 32GB iPhone SE 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 32GB iPhone 6 64GB iPhone 6 64GB iPhone 6 64GB iPhone 6 64GB iPhone 6 128GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 32GB iPhone 6S 32GB iPhone 6S 32GB iPhone 6S 64GB iPhone 6S 64GB iPhone 6S 64GB iPhone 6S 128GB iPhone 6S Plus 16GB iPhone 6S Plus 16GB iPhone 6S Plus 32GB iPhone 6S Plus 64GB iPhone 6S Plus 64GB iPhone 6S Plus 128GB iPhone 7 32GB iPhone 7 32GB iPhone 7 32GB iPhone 7 32GB iPhone 7 128GB iPhone 7 128GB iPhone 7 128GB iPhone 7 128GB iPhone 7 256GB iPhone 7 256GB iPhone 7 Plus 128GB iPhone 7 Plus 256GB iPhone 8 64GB iPhone 8 64GB iPhone 8 256GB iPhone 8 Plus 64GB iPhone 8 Plus 256GB iPhone X 64GB iPhone X 256GB iPhone X 256GB Samsung S6 Samsung S6 Edge Samsung S7 Samsung S7 Edge Samsung S8 Samsung S8 Samsung S8+ Samsung S8+ Samsung Note 8 Samsung S9+ Grade A+ A A/B C A A/B C CPO A+ A A/B C A/B A+ A A/B C A/B A+ A A/B C A A/B C A A/B C A/B CPO A/B A/B CPO A/B CPO A+ A A/B C A+ A A/B C CPO A/B CPO CPO A+ A/B A/B A/B A/B A/B CPO A/B A+ A+ A+ A+ A+ A+ A+ A+ A+ A+ Price (GBP) £ 80 £ 75 £ 70 £ 55 £ 85 £ 80 £ 65 £ 125 £ 120 £ 120 £ 105 £ 85 £ 115 £ 130 £ 135 £ 120 £ 100 £ 135 £ 140 £ 140 £ 120 £ 105 £ 155 £ 125 £ 120 £ 165 £ 135 £ 130 £ 145 £ 240 £ 155 £ 165 £ 280 £ 170 £ 295 £ 200 £ 200 £ 175 £ 165 £ 215 £ 225 £ 195 £ 185 £ 325 £ 240 £ 420 £ 430 £ 325 £ 300 £ 360 £ 380 £ 430 £ 485 £ 675 £ 535 £ 125 £ 135 £ 135 £ 165 £ 255 £ 235 £ 275 £ 255 £ 265 £ 280 Price (EUR) € 91 € 86 € 80 € 63 € 97 € 91 € 74 € 143 € 137 € 137 € 120 € 97 € 131 € 148 € 154 € 137 € 114 € 154 € 160 € 160 € 137 € 120 € 177 € 143 € 137 € 188 € 154 € 148 € 165 € 274 € 177 € 188 € 319 € 194 € 336 € 228 € 228 € 200 € 188 € 245 € 257 € 222 € 211 € 371 € 274 € 479 € 490 € 371 € 342 € 410 € 433 € 490 € 553 € 770 € 610 € 143 € 154 € 154 € 188 € 291 € 268 € 314 € 291 € 302 € 319 VAT REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN REVERSE MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN REVERSE MARGIN REVERSE REVERSE REVERSE


Stock List May 21st 98%

Model iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 32GB iPhone 5S 32GB iPhone 5S 32GB iPhone SE 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 32GB iPhone 6 64GB iPhone 6 64GB iPhone 6 64GB iPhone 6 64GB iPhone 6 128GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 32GB iPhone 6S 32GB iPhone 6S 32GB iPhone 6S 64GB iPhone 6S 64GB iPhone 6S 64GB iPhone 6S 128GB iPhone 6S Plus 16GB iPhone 6S Plus 16GB iPhone 6S Plus 32GB iPhone 6S Plus 64GB iPhone 6S Plus 64GB iPhone 6S Plus 128GB iPhone 7 32GB iPhone 7 32GB iPhone 7 32GB iPhone 7 32GB iPhone 7 128GB iPhone 7 128GB iPhone 7 128GB iPhone 7 128GB iPhone 7 256GB iPhone 7 256GB iPhone 7 Plus 128GB iPhone 7 Plus 256GB iPhone 8 64GB iPhone 8 64GB iPhone 8 256GB iPhone 8 Plus 64GB iPhone 8 Plus 256GB iPhone X 64GB iPhone X 256GB iPhone X 256GB Samsung S7 Samsung S7 Edge Samsung S8 Samsung S8+ Grade A+ A A/B C A A/B C CPO A+ A A/B C A/B A+ A A/B C A/B A+ A A/B C A A/B C A A/B C A/B CPO A/B A/B CPO A/B CPO A+ A A/B C A+ A A/B C CPO A/B CPO CPO A+ A/B A/B A/B A/B A/B CPO A/B A+ A+ A+ A+ Price (GBP) £ 80 £ 75 £ 70 £ 55 £ 85 £ 80 £ 65 £ 125 £ 120 £ 120 £ 105 £ 85 £ 115 £ 130 £ 135 £ 120 £ 100 £ 135 £ 140 £ 140 £ 120 £ 105 £ 155 £ 125 £ 120 £ 165 £ 135 £ 130 £ 145 £ 240 £ 155 £ 165 £ 280 £ 170 £ 295 £ 200 £ 200 £ 175 £ 165 £ 215 £ 225 £ 195 £ 185 £ 325 £ 240 £ 420 £ 430 £ 325 £ 300 £ 360 £ 380 £ 430 £ 485 £ 675 £ 535 £ 135 £ 165 £ 255 £ 275 Price (EUR) € 91 € 86 € 80 € 63 € 97 € 91 € 74 € 143 € 137 € 137 € 120 € 97 € 131 € 148 € 154 € 137 € 114 € 154 € 160 € 160 € 137 € 120 € 177 € 143 € 137 € 188 € 154 € 148 € 165 € 274 € 177 € 188 € 319 € 194 € 336 € 228 € 228 € 200 € 188 € 245 € 257 € 222 € 211 € 371 € 274 € 479 € 490 € 371 € 342 € 410 € 433 € 490 € 553 € 770 € 610 € 154 € 188 € 291 € 314 VAT REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN REVERSE MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN REVERSE REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN


Reverse-Ontology-Matching 95%

Reverse Ontology Matching Jorge Martinez-Gil University of Malaga Dept.


Win213R Lec ArraysR -1- 94%

Reversing Arrays There are several ways to reverse the elements of an array.


2015 94%

Reverse tanto;


pfc PFR40V45CT 90%

* Molded Plastic TO-220AB, TO-262, TO-263, and ITO-220 packages Case Styles PFR40V45CT PFR40V45CTF 2 1 Anode Common Cathode PFR40V45CTI 2 3 Anode TO-220AB Anode 1 Common Cathode ITO-220 PFR40V45CTB 2 2 3 Anode 1 Common Cathode 3 Anode Anode TO-262 Anode 1 Common Cathode 3 Anode TO-263 ________________________________________________________________________________________________ Version 0.0 - Dec 2008 1 PFC Device Corporation PFR40V45CT PFR40V45CTF PFR40V45CTI PFR40V45CTB Maximum Ratings and Electrical Characteristics SYMBOL UNITS VRM VRWM VRRM 45 Volts IO 40 Amps Peak Forward Surge Current - 1/2 60hz IFSM 300 Amps Peak Repetitive Reverse Surge Current (2uS-1Khz) IRRM 2 Amps Instantaneous Forward Voltage (per leg) IF = 20A;


C4 General Data 90%

C4/C5 - General Reference Data Intermediate– Tighten 10 ft pounds and back off 1 3/4 turns Line Tap Line Pressure Spec’s Drive - Idle 55-65 WOT 150-165 Reverse - Idle 60-110 WOT 240-270 L/R hub freewheels CW.


Star Deals Graded Stocklist 2 90%

Model iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 16GB iPhone 5S 32GB iPhone 5S 32GB iPhone 5S 32GB iPhone 6 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 16GB iPhone 6 32GB iPhone 6 64GB iPhone 6 64GB iPhone 6 64GB iPhone 6 64GB iPhone 6 128GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 16GB iPhone 6S 32GB iPhone 6S 32GB iPhone 6S 32GB iPhone 6S 64GB iPhone 6S 64GB iPhone 6S 64GB iPhone 6S 128GB iPhone 6S Plus 16GB iPhone 6S Plus 32GB iPhone 6S Plus 64GB iPhone 7 32GB iPhone 7 32GB iPhone 7 32GB iPhone 7 32GB iPhone 7 128GB iPhone 7 128GB iPhone 7 128GB iPhone 7 128GB iPhone 7 256GB iPhone 8 64GB iPhone 8 64GB iPhone 8 256GB iPhone 8 Plus 64GB iPhone 8 Plus 256GB iPhone X 64GB iPhone X 256GB Samsung S7 Samsung S7 Edge Samsung S8 Samsung S8+ Grade A+ A A/B C A A/B C A+ A A/B C A/B A+ A A/B C A/B A+ A A/B C A A/B C A A/B C A/B A/B A/B A/B A+ A A/B C A+ A A/B C A/B A+ A/B A/B A/B A/B A/B A/B A+ A+ A+ A+ Price (GBP) £ 80 £ 75 £ 70 £ 55 £ 85 £ 80 £ 65 £ 120 £ 120 £ 105 £ 85 £ 115 £ 130 £ 135 £ 120 £ 100 £ 135 £ 140 £ 140 £ 120 £ 105 £ 155 £ 125 £ 120 £ 165 £ 135 £ 130 £ 145 £ 155 £ 165 £ 170 £ 200 £ 200 £ 175 £ 165 £ 215 £ 225 £ 195 £ 185 £ 240 £ 325 £ 300 £ 360 £ 380 £ 430 £ 485 £ 535 £ 135 £ 165 £ 255 £ 275 Price (EUR) € 92 € 87 € 81 € 63 € 98 € 92 € 75 € 138 € 138 € 121 € 98 € 133 € 150 € 156 € 138 € 115 € 156 € 161 € 161 € 138 € 121 € 179 € 144 € 138 € 190 € 156 € 150 € 167 € 179 € 190 € 196 € 231 € 231 € 202 € 190 € 248 € 260 € 225 € 213 € 277 € 375 € 346 € 415 € 438 € 496 € 559 € 617 € 156 € 190 € 294 € 317 VAT REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN REVERSE MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN MARGIN


Star Deals Stock List May 2nd 89%

Model iPhone XS 64GB iPhone XS 256GB iPhone XS 512GB Samsung Galaxy S3 Samsung Galaxy S3 Mini Samsung Galaxy S4 Mini Samsung Galaxy Note 5 Samsung Galaxy S7 32GB Samsung Galaxy S7 Edge Samsung Galaxy S8 64GB Samsung Galaxy S8+ 64GB Samsung Galaxy J1 Samsung Galaxy J320 Huawei P10 Lite Huawei Y5 Huawei Y7 Prime HTC Desire 510 HTC Desire 626 HTC Desire 816 HTC One X+ 64GB LG G3 S LG K11 Nokia 3 iPhone 5S 16GB iPhone 6 16GB iPhone 6 64GB iPhone 6S 16GB iPhone 7 32GB iPhone 7 128GB iPhone 8 64GB Samsung Galaxy S4 Samsung Galaxy Note 2 Samsung Galaxy Note 3 iPhone 5 16GB iPhone 5S 16GB iPhone SE 16GB iPhone 6 16GB iPhone 6 64GB iPhone 6 Plus 64GB iPhone 6S 16GB iPhone 6S 64GB iPhone 6S Plus 64GB iPhone 7 32GB Grade Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap Swap A+ Refurb A+ Refurb A+ Refurb A+ Refurb A+ Refurb A+ Refurb A+ Refurb A+ Refurb A+ Refurb A+ Refurb A A A A A A A A A A Qty 85 70 90 50 75 50 120 20 230 300 15 50 500 300 600 50 100 100 60 70 50 50 50 110 80 150 95 200 180 400 50 70 60 130 120 110 200 220 250 350 135 120 300 Price (GBP) £ 795 £ 890 £ 940 £ 80 £ 55 £ 80 £ 170 £ 140 £ 170 £ 265 £ 285 £ 65 £ 80 £ 140 £ 70 £ 125 £ 60 £ 80 £ 70 £ 70 £ 65 £ 110 £ 70 £ 80 £ 125 £ 135 £ 145 £ 210 £ 225 £ 335 £ 80 £ 85 £ 95 £ 70 £ 90 £ 115 £ 135 £ 150 £ 185 £ 140 £ 185 £ 255 £ 215 Price (EUR) € 925 € 1,036 € 1,094 € 93 € 64 € 93 € 198 € 163 € 198 € 308 € 332 € 76 € 93 € 163 € 81 € 145 € 70 € 93 € 81 € 81 € 76 € 128 € 81 € 93 € 145 € 157 € 169 € 244 € 262 € 390 € 93 € 99 € 111 € 81 € 105 € 134 € 157 € 175 € 215 € 163 € 215 € 297 € 250 Spec UK/EU Spec UK/EU Spec UK/EU Spec F Model F Model F Model F Model F Model F Model F Model F Model F Model F Model UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec US Spec US Spec US Spec US Spec US Spec US Spec US Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec VAT Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Reverse Reverse Reverse Reverse Reverse Reverse Reverse Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal iPhone 7 128GB iPhone 7 Plus 32GB iPhone 7 Plus 128GB iPhone 7 Plus 256GB iPhone 8 64GB iPhone 8 256GB iPhone 8 Plus 64GB iPhone 8 Plus 256GB iPhone X 64GB iPhone X 256GB iPhone XS Max 64GB iPhone XS Max 256GB iPhone XS Max 512GB Samsung Galaxy S6 Samsung Galaxy S6 Edge Samsung Galaxy S8 Samsung Galaxy S8+ Samsung Galaxy S9+ Samsung Galaxy Note 4 Samsung Galaxy Note 8 Samsung Galaxy A3 2016 Samsung Galaxy A5 2015 Samsung Galaxy A5 2016 Samsung Galaxy J5 2015 Samsung Galaxy J5 2016 HTC Desire 626s iPhone 6 Plus 64GB iPhone 7 32GB iPhone 7 128GB iPhone X 64GB iPhone X 256GB Samsung Galaxy S8 Samsung Galaxy S8+ Samsung Galaxy Note 8 iPhone X 64GB Samsung Galaxy S8 Samsung Galaxy S8+ Samsung Galaxy Note 8 A A A A A A A A A A A A A A A A A A A A A A A A A A A/B A/B A/B A/B A/B B B B C C C C 150 110 135 90 300 260 80 75 270 180 160 135 105 50 50 150 100 200 50 140 50 50 50 180 60 100 240 250 200 180 115 90 100 130 150 170 200 125 £ 235 £ 300 £ 330 £ 340 £ 335 £ 375 £ 415 £ 480 £ 515 £ 565 £ 855 £ 965 £ 1,050 £ 140 £ 150 £ 245 £ 265 £ 370 £ 120 £ 300 £ 90 £ 80 £ 105 £ 80 £ 85 £ 65 £ 175 £ 185 £ 200 £ 510 £ 555 £ 235 £ 255 £ 290 £ 485 £ 220 £ 240 £ 280 € 273 € 349 € 384 € 396 € 390 € 436 € 483 € 558 € 599 € 657 € 995 € 1,123 € 1,222 € 163 € 175 € 285 € 308 € 430 € 140 € 349 € 105 € 93 € 122 € 93 € 99 € 76 € 204 € 215 € 233 € 593 € 646 € 273 € 297 € 337 € 564 € 256 € 279 € 326 UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec F Model F Model F Model F Model F Model F Model F Model F Model F Model F Model F Model F Model UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec UK/EU Spec F Model F Model F Model UK/EU Spec F Model F Model F Model Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal Marginal


NoSuchCon2013-re-chall-writeup-v1.0 89%

@KUTIOO KUTIOO@GMAIL.COM Table of contents Nosuchcon 2013 – Write up ..........................................................................................................................................1 Introduction ...............................................................................................................................................................2 Bad ideas and Pin tracing...........................................................................................................................................3 Step by step ...........................................................................................................................................................3 Hardware breakpoints on the serial and on the output ........................................................................................3 Generic unobfuscators ..........................................................................................................................................3 Reverse by hand ....................................................................................................................................................4 Pin tracing ..............................................................................................................................................................4 Automated deobfuscation .........................................................................................................................................6 Simple table (TS) ....................................................................................................................................................6 Handlers table (THS) ..............................................................................................................................................8 16-bit table (T16S) .................................................................................................................................................9 Full state machine................................................................................................................................................11 Extract tables .......................................................................................................................................................12 Cryptanalysis on the AES Whitebox .........................................................................................................................13 Static Single Assignment form .............................................................................................................................13 Graph ...................................................................................................................................................................13 Rounds .................................................................................................................................................................15 Cryptanalysis ........................................................................................................................................................15 Automated attack ................................................................................................................................................16 Conclusion ...............................................................................................................................................................19 INTRODUCTION This year, The NoSuchCon2013 challenge was created by Eloi Vanderbeken from Oppida.





Reverse IP Lookup - 87%

1/12/2017 Tools Reverse IP Lookup - API Research Data > Tools > Reverse IP Lookup Takes a domain or IP address and does a reverse lookup to quickly shows all other domains hosted from the same server. Useful for finding phishing sites or identifying other sites on the same shared hosting server.


ChangeLog SOEN344 Team3 87%

Change Log GitHub Issue Item ID TEAM 3 - SOEN 344 Problem(s) Solution Communication Diagram Initiate Reservation Session Inconsistent type signature for many operations Corrected in SAD by reverse engineering 2017/02/11 #6 Communication Diagram Create Reservation The communication diagram is inconsistent with the code.


Konstabel 1 pdftræning 87%

Uge 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 8 Armbøjninger 6 Situps 5 Planke 15 sekunder Rygextentions 12 Lunges 12 Armbøjninger 7 Mavebøjninger 10 Planke 15 sekunder Rygextentions 12 Squat 8 reverse chair dips 10 Cykle med ben 15 sekunder Planke 20 sekunder Rygextentions 12 Uge 2 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 12 Armbøjninger 8 Situps 7 Planke 20 sekunder Rygextentions 15 Lunges 14 Armbøjninger 8 Mavebøjninger 12 Planke 20 sekunder Rygextentions 15 Squat 12 Reverse chair dips 10 Cykle med ben 20 sekunder Planke 20 sekunder Rygextentions 15 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder Uge 3 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 12 Reverse chair dips 12 Situps 12 Planke 25 sekunder Rygextentions 15 Lunges 14 Armbøjninger 12 Mavebøjninger 14 Planke 25 sekunder Rygextentions 15 Squat 12 Armbøjninger 12 Cykle med ben 20 sekunder Planke 25 sekunder Rygextentions 15 Fase 2 start uge 4 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 10 Reverse Chair dips 12 Situps 12 Planke 25 sekunder Rygextentions 15 Lunges 12 Armbøjninger 10 Mavebøjninger 15 Planke 30 sekunder Rygextentions 15 Squat 12 Armbøjninger 12 Cykle med ben 25 sekunder Planke 30 sekunder Rygextentions 15 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder uge 5 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 12 Armbøjninger 12 Situps 12 Planke 30 sekunder Rygextentions 15 Lunges 16 Armbøjninger 12 Mavebøjninger 15 Planke 35 sekunder Rygextentions 15 Squat 14 Reverse Chair dips 15 Cykle med ben 30 sekunder Planke 35 sekunder Rygextentions 15 uge 6 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Squat Armbøjninger Situps Planke Rygextentions Lunges Armbøjninger Mavebøjninger Planke Rygextentions Squat Armbøjninger Situps Planke Rygextentions Gentagelser 15 15 15 40 sekunder 15 18 15 15 40 sekunder 15 25 10 25 45 sekunder 20 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 4 4 4 4 4 4 4 4 4 4 1 1 1 1 1 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder Sæt


Konstabel1styrke 87%

Konstabel 1 Træningsprogram Uge 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 8 Armbøjninger 6 Situps 5 Planke 15 sekunder Rygextentions 12 Lunges 12 Armbøjninger 7 Mavebøjninger 10 Planke 15 sekunder Rygextentions 12 Squat 8 reverse chair dips 10 Cykle med ben 15 sekunder Planke 20 sekunder Rygextentions 12 Uge 2 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 12 Armbøjninger 8 Situps 7 Planke 20 sekunder Rygextentions 15 Lunges 14 Armbøjninger 8 Mavebøjninger 12 Planke 20 sekunder Rygextentions 15 Squat 12 Reverse chair dips 10 Cykle med ben 20 sekunder Planke 20 sekunder Rygextentions 15 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder Uge 3 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 12 Reverse chair dips 12 Situps 12 Planke 25 sekunder Rygextentions 15 Lunges 14 Armbøjninger 12 Mavebøjninger 14 Planke 25 sekunder Rygextentions 15 Squat 12 Armbøjninger 12 Cykle med ben 20 sekunder Planke 25 sekunder Rygextentions 15 Fase 2 start uge 4 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 10 Reverse Chair dips 12 Situps 12 Planke 25 sekunder Rygextentions 15 Lunges 12 Armbøjninger 10 Mavebøjninger 15 Planke 30 sekunder Rygextentions 15 Squat 12 Armbøjninger 12 Cykle med ben 25 sekunder Planke 30 sekunder Rygextentions 15 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder uge 5 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Gentagelser Sæt Squat 12 Armbøjninger 12 Situps 12 Planke 30 sekunder Rygextentions 15 Lunges 16 Armbøjninger 12 Mavebøjninger 15 Planke 35 sekunder Rygextentions 15 Squat 14 Reverse Chair dips 15 Cykle med ben 30 sekunder Planke 35 sekunder Rygextentions 15 uge 6 Dag 1 Dag 1 Dag 1 Dag 1 Dag 1 Dag 2 Dag 2 Dag 2 Dag 2 Dag 2 Dag 3 Dag 3 Dag 3 Dag 3 Dag 3 Øvelse Squat Armbøjninger Situps Planke Rygextentions Lunges Armbøjninger Mavebøjninger Planke Rygextentions Squat Armbøjninger Situps Planke Rygextentions Gentagelser 15 15 15 40 sekunder 15 18 15 15 40 sekunder 15 25 10 25 45 sekunder 20 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 4 4 4 4 4 4 4 4 4 4 1 1 1 1 1 Hvile efter sæt 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 60 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder 30 sekunder Sæt


manufacturing chart 87%

Reverse Engineering Tengu Hull Section Mechanical Engineering + x1 Electromechanical Hull Sheeting Cartesian Temporal Coordinator + x1 5 x Graphene Nanoribbons Powdered C-540 Graphite Modified Fluid Router + x5 Electromechanical Interface Nexus + x3 x1 10 x Lanthanum Metallofullerene Electromechanical Interface Nexus 10 x PPD Fullerene Fibers 2 x Fulleroferrocene Power Conduit 9 x Fullerene Intercalated Sheets 1 x Emergent Neurovisual Interface 15 x R.A.M.


2010 Colinet et al. FEBS 86%

The only exception was Drosophila watanabei, where a low level Gene Primer sequence (5¢- to 3¢) RpS20 (forward) RpS20 (reverse) Hsp22 (forward) Hsp22 (reverse) Hsp23 (forward) Hsp23 (reverse) Hsp26 (forward) Hsp26 (reverse) Hsp27 (forward) Hsp27 (reverse) Hsp40 (forward) Hsp40 (reverse) Hsp60 (forward) Hsp60 (reverse) Hsp67Ba (forward) Hsp67Ba (reverse) Hsp68 (forward) Hsp68 (reverse) Hsp70Aa (forward) Hsp70Aa (reverse) Hsc70-1 (forward) Hsc70-1 (reverse) Hsp83 (forward) Hsp83 (reverse) CCGCATCACCCTGACATCC TGGTGATGCGAAGGGTCTTG GCCTCTCCTCGCCCTTTCAC TCCTCGGTAGCGCCACACTC GGTGCCCTTCTATGAGCCCTACTAC CCATCCTTTCCGATTTTCGACAC GTCACATCATGCGCCACTTTG TTGTAGCCATCGGGAACCTTGTAG GGCCACCACAATCAAATGTCAC CTCCTCGTGCTTCCCCTCTACC GAGATCATCAAGCCCACCACAAC CGGGAAACTTAATGTCGAAGGAGAC ACATCTCGCCGTACTTCATCAACTC GGAGGAGGGCATCTTGGAACTC TGGATGAACCCACACCCAATC CGAGGCAACGGGCACTTC GAAGGCACTCAAGGACGCTAAAATG CTGAACCTTGGGAATACGAGTG TCGATGGTACTGACCAAGATGAAGG GAGTCGTTGAAGTAGGCTGGAACTG TGCTGGATGTCACTCCTCTGTCTC TGGGTATGGTGGTGTTCCTCTTAATC GGACAAGGATGCCAAGAAGAAGAAG CAGTCGTTGGTCAGGGATTTGTAG Fragment length (bp) 134 66 153 52 171 112 66 89 88 98 87 150 of upregulation of Hsp70 mRNA was observed, not only during cold exposure, but also during recovery from cold.


Aikido Katas 86%

Gyaku Uchi Ude Hineri Normal outside release Normal outside hand push Reverse outside release Reverse outside hand push Normal inside release Normal inside arm twist Reverse inside release Reverse inside arm twist Palm down Palm up Palm up Palm down Palm down Palm up Palm up Palm down NI JU SAN HON KATA (a.k.a.


Wolfe Waves 86%

It is very common for the market to overshoot point 5 by a small margin, so you must wait for the price to reverse back above the trendline before initiating a trade.


Complete 85%

8-4PM #03 FACTORY MSRP • 2.0L I4 HEV Engine • Key-Ring Remote Start • E-CVT Auto Transmission • SmartGauge w/EcoGuide • AdvanceTrac w/RSC • 19” Aluminum Wheels • 10 Airbags/AirCurtains • Dual-Zone Climate Control • Driver’s Memory System • Leather/Heated Seats • Power Windows/Locks • Heated/Powerfold Mirrors • Cruise/Tilt/Telescoping • Stereo/CD/MP3/USB/SD • SYNC w/MyLincoln Touch w/Voice Activated System • 8” LCD Touch Screen • SiriusXM Satellite/Bluetooth • Reverse Sensing System w/Rear Vision Camera • Stock # 4600 $ $ 41,745 YOU PAY 37,445 Own It $0 Down $ OWNER LOYALTY PROGRAM COMPETITIVE CONQUEST BONUS CASH $ $ 1,250 OFF $ 395 SAVE $4,300 Net $4,300 Dealer Discount off MSRP $1,000 DOWN $0 DOWN 39 MONTH MO Off Factory MSRP 2,250 OFF LEASE 566 2.85% for 72 mo MO $ 367 $2,000 DOWN $ MO 341 MO Shown with optional features • 3.7L Ti-VCT V6 Engine • Key-Ring Remote Start • 6-Speed SelectShift • AdvanceTrac w/RSC • 20” Painted Wheels • 7 Airbags/AirCurtains • Dual-Zone Climate Control • Driver’s Memory System • Leather/Htd/Cooled Seats • Heated/Signal Mirrors • AM/FM Stereo/CD/USB/SD • SYNC w/MyLincoln Touch Voice-Activated System • 8” LCD Touch Screen • SiriusXM Satellite/Bluetooth • SOS Post-Crash Alert System • Blind Spot Monitoring • Lane Keeping System • Active Park Assist • F&R Sensing Systems w/Camera • Stock # 5446 FACTORY MSRP $ $ 46,510 YOU PAY OWNER LOYALTY PROGRAM 43,305 $ 1,500 OFF Own It $0 Down $ 655 COMPETITIVE CONQUEST BONUS CASH MO 2.85% for 72 mo $ SAVE $3,205 Off Factory MSRP Net $3,205 Dealer Discount off MSRP $0 DOWN 39 MONTH LEASE 1,500 OFF $ 473 MO $1,000 DOWN $ 446 MO $2,000 DOWN $ 419 MO Shown with optional features • 2.0L EcoBoost I-4 Turbo • Key-Ring Remote Start • 6-Speed Automatic • AdvanceTrac w/RSC • Class II Trailer Tow Package • 18” Premium Painted Wheels • 7 Airbags/AirCurtains • Dual-Zone Climate Control • Driver’s Memory System • Leather/Heated Seats • Power Windows/Locks • Heated Steering Wheel • Heated/Power Mirrors • Cruise/Tilt/Telescoping • Stereo/CD/MP3/USB/SD • SYNC w/MyLincoln Touch w/Voice Activated System • SiriusXM Satellite/Bluetooth • Reverse Sensing System w/Rear Vision Camera • Stock # 4585 FACTORY MSRP $ $ OWNER LOYALTY PROGRAM $ 1,000 OFF COMPETITIVE CONQUEST BONUS CASH $ Leases disclosure.



INTRODUCTION 2 02.1 What is natural osmosis and reverse osmosis?
