Appendix 1 thesis.pdf


Preview of PDF document appendix-1-thesis.pdf

Page 1...5 6 789368

Text preview


2/11/2016

NCBI Blast:c2

Sbjct  66   GGCAATCCTGAGCCAAATCCTTCTTTCCGAAAACAAAAAACTAAAAGTTCAGAAAAAAAG  125 
Query  61   GATAGGTGCAGAGACTC  77 
            ||||||||||||||||| 
Sbjct  126  GATAGGTGCAGAGACTC  142 

Vicia faba var. minor tRNA­Leu (trnL) gene, partial sequence; chloroplast
Sequence ID: gb|JN617168.1| Length: 938 Number of Matches: 1
Range 1: 554 to 630
Score

Expect

Identities

Gaps

Strand

134 bits(148)

1e­28()

76/77(99%)

0/77(0%)

Plus/Minus

Frame

Features:
Query  1    GGCAATCCTGAGCCAAATCCTTCTTTCCaaaaacaaaaaactaaaagttcagaaaaaaaG  60 
            |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| 
Sbjct  630  GGCAATCCTGAGCCAAATCCTTCTTTCCGAAAACAAAAAACTAAAAGTTCAGAAAAAAAG  571 
Query  61   GATAGGTGCAGAGACTC  77 
            ||||||||||||||||| 
Sbjct  570  GATAGGTGCAGAGACTC  554 

Vicia faba var. major tRNA­Leu (trnL) gene, partial sequence; chloroplast
Sequence ID: gb|JN617167.1| Length: 949 Number of Matches: 1
Range 1: 558 to 634
Score

Expect

Identities

Gaps

Strand

134 bits(148)

1e­28()

76/77(99%)

0/77(0%)

Plus/Minus

Frame

Features:
Query  1    GGCAATCCTGAGCCAAATCCTTCTTTCCaaaaacaaaaaactaaaagttcagaaaaaaaG  60 
            |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| 
Sbjct  634  GGCAATCCTGAGCCAAATCCTTCTTTCCGAAAACAAAAAACTAAAAGTTCAGAAAAAAAG  575 
Query  61   GATAGGTGCAGAGACTC  77 
            ||||||||||||||||| 
Sbjct  574  GATAGGTGCAGAGACTC  558 

http://blast.ncbi.nlm.nih.gov/Blast.cgi

7/7